by Paul Gilster | Nov 20, 2009 | Exoplanetary Science |
The goal of detecting a terrestrial class exoplanet has burned bright in the imagination ever since the discovery of the first planets orbiting main sequence stars. In a recent SEED Magazine story, Lee Billings (one of the most graceful science writers now working) harkens back to then NASA administrator Daniel Goldin’s 1996 speech at the American Astronomical Society meeting in San Antonio, Texas. Goldin talked about seeing Earth-like exoplanets up close, speculating that in 25 years we might be able to obtain images with a resolution to see clouds, continents and oceans.
I’m going to use a different Goldin quote than Lee did, from a later speech, but the idea is clear enough in either iteration. Here Goldin is speaking about the classrooms of the mid-21st Century and what they might look like:
When you look on the walls, you see a dozen maps detailing the features of Earth-like planets orbiting neighboring stars. Schoolchildren can study the geography, oceans, and continents of other planets and imagine their exotic environments, just as we studied the Earth and wondered about exotic sounding places like Bangkok and Istanbul . . . or, in my case growing up in the Bronx, exotic far-away places like Brooklyn.
This is a classroom I’d love my grandchildren to spend some time in, but exactly which generation gets to do that depends on how timely we are in creating the kind of terrestrial planet finder missions that can do the job. With a star outshining a terrestrial exoplanet by a huge factor, the challenge of just finding the planet is, as Billings notes, “…like photographing a lit match on the cusp of a detonating hydrogen bomb.” And in any case, we seem to have set up a built-in generational gap here. We’re making huge progress today at detecting exoplanets, but funding for the follow-up investigative tools is sadly lacking.
This is why I’ve often looked at starshade concepts on Centauri Dreams, thinking the technology of an external occulter could simplify the detection process and, in doing so, lower the costs of the project. Webster Cash (University of Colorado at Boulder) has spent the last five years working on a starshade that could function with the upcoming James Webb Space Telescope. The cost: $700 million to image alien Earths around nearby stars, a fraction of the price of the original TPF-C and TPF-I concepts worked up at the Jet Propulsion Laboratory.
We’re not talking about those Goldin-style images of Earth-like worlds on the schoolhouse wall, at least, not with the earliest generation of starshade. But Cash does believe we can use the early starshades to get a spectrum of an Earth-like exoplanet within the next ten years. That could flag the presence of oceans and even reveal signs of life.
Here’s Billings’ description of the operative technology:
Cash’s starshade would resemble a many-petaled sunflower—if sunflowers were matte-black and about half a football field in diameter. Its special shape is designed so that waves of starlight will diffract around it, lapping against and nullifying each other to cast an ultra-dark shadow, ensuring that only an exoplanet’s light falls on the JWST’s huge mirror. Equipped with small thrusters, the starshade would fly some 70,000 kilometers in front of the JWST, precisely aligning to block light from a target star so that its accompanying planets could be seen.
Read the article for more on this (and, if you’re looking for further background, run a search on this site for stories on Cash’s work). And keep this in mind. Astro2010 is a decadal survey of astrophysicists put together by the National Research Council, one that will soon release a report on research priorities for the coming decade. Cash’s starshade has been submitted to the committee, and so has a competing starshade concept by David Spergel and Jeremy Kasdin (Princeton University), former Cash collaborators. Will the committee support a starshade?
The lack of support from NASA on bringing such projects home is a natural consequence of the funding crisis the agency faces, one that may or may not change no matter what the upcoming Astro2010 report has to say. “The problem here is not the technology, but the lack of money to demonstrate it one way or another — and there’s something wrong with that,” Cash tells Billings. “This wouldn’t be just helping me, it would be NASA helping itself. NASA has a unique opportunity to conduct an experiment whose results, if positive, will never be forgotten.”
by Paul Gilster | Nov 19, 2009 | Astrobiology and SETI |
by Joe Davis
Yesterday we followed Joe Davis’ adventures in Puerto Rico as he arranged for the transmission of a message to the stars near the 35th anniversary of the famous message to M13, sent from the same site in 1974. Today Davis concludes the story, with a look at how the ‘RuBisCo’ message was put together, and thoughts on the ins and outs of getting unusual projects approved in today’s scientific climate.
I had a sort of showdown with Arecibo’s interim Director, Dr. Michael C. Nolan at the last minute and Danielle Hofmans’ detailed notes have made it possible for me to recount that conversation here. Nolan’s main problem was about politics. Arecibo once received a “Golden Fleece” award from Senator Proxmire for its involvement with the search for extraterrestrial intelligence, including its role in the Sagan-Drake transmission of 1974. That recollection has special resonance now since there are very serious ongoing concerns about future funding for the observatory.
Nolan argued that 35 years ago, the efforts of Carl Sagan and Frank Drake were carried out in a way that made “no sense”. I explained that projects concerned with the search for extraterrestrial intelligence are really more about a search for ourselves; that they make us look much more intensely at ourselves than we look away into space and that nobody seems to see that part of it. I wanted to make clear to him that this was not really a project about “aliens”.
Nolan countered that “Now you’re being too rational.” He seemed amused because I think he actually understood what I was trying to tell him, but his concern was that of the operator of a federally funded organization. He knows that he can’t sell ideas like these to politicians and university funding officers. He complained about the Byzantine ins and outs of funding both at federal and university levels. He said he was afraid of doing “marginal” things because he felt that projects like mine might ultimately get in the way of “serious” science. In spite of these concerns, Nolan added, something like, “We’re still negotiating. I still want to do this.”
Image credits (all images): Ashley Clark.
I pointed out that CETI in general addresses fundamental questions like “Is this who we are?” and “Is this what we know?” I asked him point blank if Arecibo was actually ashamed of the Sagan-Drake CETI message. Nolan answered that Drake’s scientific reputation has indeed been called into question (I don’t know why). He wasn’t very positive about Sagan either, except to say that he helped to popularize astronomy. At one point, Nolan proposed that I enter into collaboration with local amateur (ham) radio operators (which involves the use of Arecibo Radar to bounce radio signals off the moon) because, he said, “I’m licensed to take pictures of asteroids, not to do things like this.”
Almost as a last line of defense, I was advised of Arecebo’s disabled “coder”. I knew that I had to solve this problem at once or the allotted time on Arecibo Radar would run out. I would miss the opportunity to transmit signals on the 35th anniversary and perhaps, miss the opportunity altogether.
I pulled out my laptop and brought up pictures of the band-pass filter and gate used to get analog signals interfaced with Millstone radar 25 years ago. Nolan acknowledged that something like that might be possible at Arecibo, but he still seemed to be backpedaling. He asked how fast I could get that apparatus to Puerto Rico, knowing full well that even if I had it air-freighted from Cambridge, there would be no way it would arrive before my access to the radar would end on Monday (09 Nov). He suggested that I should consider putting off the whole project until some indefinite future date.
I realized that whatever options remained, they would have to be produced immediately with no time even to go away and fabricate something in say, a local machine shop (which of course, would be closed on the following day, a Sunday). I started thinking about what I had in my bags and in my pockets. I had my iPhone (eureka!). I also had a funky television connector inadvertently left in my computer bag from some earlier episode of trash mining in Cambridge and as it turned out, that connector was a crucial component needed to connect my iPhone to the radar. I proposed creating a sound file from the RuBisCo sequence that could then be recorded on my iPhone and interfaced with the radar. At that point, a surprised and still amused Michael Nolan relented.
But there was one last problem: How could the gene be sent out as a coded signal? One way would be to prepare a binary map by assigning numerical values to DNA nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The result is a 2868-bit binary sequence that is less than twice as large as the 1679-bit Sagan-Drake CETI message. Like the Sagan-Drake message, a transmission containing the RuBisCo sequence could be transmitted in a very brief period of time owing to its relatively small size:
1001110100100000100010101000101110111000011010101100101011011101011
1111001010010101011000111110111010110101011101101100010101001011110
0001011001011001100001000001111011011000001010100000101011111001100
0011110011001100101111100101100100101000011101101101000010000010010
1000000111111011010100001000000111101011101011001011111111000011001
1110110110001110000111010010001010001100001111101100010011111100010
1000011101100111111000001110011111100001011000001011000001011110010
0110101100010101011111100111001110001100000110010010011101100110111
0101110101111110111010101010111001001010011001100101110001011001110
1101100010110000000010101101110000001010101011110101110101111010100
0111010110000010100010011101010110000101000010010111011011110110100
0110110010101111111010100101010110000000111001100110001000110001101
0001111110101110010001110011101001000000010000011100010110011101011
0101010000101010000101011110100001100000100100111111110010000101011
0101111010101110111001101010010111101000101011011001111101001101000
0000001110101111111100111011000011001011010100000011010100101111111
1101011001000111000110101010100001100011110110111011000111010101100
1111010011101000101001100111101111110000101111001010101100000101010
1110011110011110111010001101111010000100100010100000100101011001110
0110101111110111011100100110101010001011001010101110111000011101011
0010000101011001101010110010001011110001111010100010111101111010100
1001010101111110010010110000101111010011100011000011100101111011000
1001110011101011101010011110010010101010111011000111011001010111000
1101110111010010111111100110101000011100100110110100111001001111000
0110000101101000111111111111100101001000001100101010011000011011000
1011111000100100101100101110000111011100110100111110100011000010100
0101001000100100001000001101110010100111001001110011110101100101111
0011011100010111010111010010010011111011001000010000101000011111101
1001011011001010101011001101011000110110011101000111110111111011100
1001001100101001000010001111101100000110110110110111101101010000101
1110101111011110101011101110001001101000010101111111000101011101011
1100101011000011100110111100111100101010111010111101000101011100100
1110101101001100111101100101011001010100100001001010111001011111110
1000100010101100000101111011101010001100000001101111100010100101111
1011110110010100100011010101111100100110011100000111000100011110000
0111011100100010101111111111001111001010000110110000110001011010100
1111011111101111101000010101101111100010010000010111111111011010011
1001100001011110111000011011011000110100100111011011011000100011011
1010110010011101110110101010110001001101101001111010111110001101111
0010001011100010010111110101111011010011110101001011001010011001110
1111000101110010101001111110110000001111101000011011000111000111000
1011101111010110110011111101010111011100100110110010101101001010101
110010110010110111111000110101010111111001101011011010
One problem with this strategy is that the gene encoded in binary lacks punctuation. Anyone receiving the signal would have to guess that four bases were being encoded as paired binary bits: 00, 01, 10 and 11, otherwise it would just be a meaningless jumble. So instead, I decided to create sound files with spoken syllables where “space-one syllable-space” = C and so on to “space-four syllables-space”=G
This phonetic encoding technique also allowed me to interpose another layer of meaning in the message. The syllables were:
C) space – “I” – space
T) space – “amthe” – space
A) space – “knowyourself” – space
G) space – “riddleoflife” – space
These coded phrases reiterate the edict of Apollo that is inscribed at the entrance to the temple at Delphi where it says, “Know yourself and you will know all of the secrets of the universe and the secrets of the gods”. I think Arecibo Observatory is somehow analogous to the temple at Delphi. Astronomers at Arecibo routinely glean the heavens to uncover such secrets. Do a little algebra and it’s obvious that they must also be learning something about ourselves.
We used Apple’s “Speak” option to vocalize the phonetic code which I then recorded on my iPhone. Here is a fragment of the total message, the whole of which can be decoded unambiguously into the gene for RuBisCo:
knowyourself amthe riddleoflife amthe I knowyourself I I knowyourself I knowyourself knowyourself knowyourself I knowyourself riddleoflife knowyourself riddleoflife knowyourself I amthe knowyourself knowyourself knowyourself riddleoflife I knowyourself
knowyourself riddleoflife amthe riddleoflife amthe amthe riddleoflife riddleoflife knowyourself amthe amthe I knowyourself knowyourself knowyourself riddleoflife I amthe riddleoflife riddleoflife amthe riddleoflife amthe amthe knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife amthe knowyourself I knowyourself knowyourself knowyourself amthe amthe riddleoflife knowyourself I amthe amthe knowyourself amthe amthe knowyourself amthe knowyourself I amthe I I amthe riddleoflife knowyourself riddleoflife amthe knowyourself I I knowyourself knowyourself knowyourself I I knowyourself knowyourself riddleoflife riddleoflife knowyourself amthe knowyourself I amthe riddleoflife knowyourself amthe knowyourself amthe knowyourself amthe amthe riddleoflife riddleoflife I knowyourself riddleoflife I knowyourself amthe amthe I I riddleoflife knowyourself riddleoflife amthe knowyourself knowyourself I amthe I I amthe I knowyourself knowyourself
The Wunderlichs, Ashley Clark, Danielle Hofmans and I spent the next couple of hours creating sound files and hacking the connections with the iPhone, assorted cables and alligator clips. While setting up the iPhone connections, we conducted test transmissions using the song, “Run Come See Jerusalem” by Bahamian musician and songwriter, Andrew Jones (Spirit House Records). At the moment we hooked up the iPhone to the radar, the energy and excitement in the Arecibo control room was literally palpable. Everyone, including Arecibo staff and visiting scientists seemed to be infected by the effort. Then, we interfaced my iPhone with Arecibo’s powerful radar and transmitted from approximately 11:30 p.m. until 12:45 a.m. The duration of each transmission was approximately 5 times longer than the 1974 Sagan-Drake transmission. We spent that hour and 15 minutes transmitting messages to the three “RuBisCo Stars” listed in the text above (see yesterday’s post).
On Sunday, I was invited to help prepare an extremely sensitive set of microwave detectors for experiments scheduled for Monday to search for pulsars. The detectors happen to be located 500 ft above the Arecibo radar dish suspended in a steel truss platform. Ashley and Danielle and I all went up there early in the afternoon. There was a sudden torrential downpour while we were still “hanging out” on the truss. I have to say it was one of the scariest, most exciting moments I’ve had in the past several years. I loved it.
There are no bars (of any kind) out at Arecibo Observatory. In order to avoid RF interference with sensitive instruments, the use of cell phones, digital cameras and video recorders are all strictly prohibited on observatory grounds.
We were nevertheless granted unprecedented access to photograph the observatory and coordinated all of our video and digital photography with the Arecibo control room. Serendipitously, Ashley Clark’s 8 x 10 film camera was the only imaging device that we were permitted to use continuously since it contains no batteries or electronics. We are also grateful to Arecibo Observatory for making accommodations there available to us through the several days in which we pursued the project.
I delivered a talk on at 11:00 a.m. on Monday 09 Nov. for Arecibo staff and scientists. I think there was visible skepticism on the faces of my audience when they walked into the room and visible excitement when they left. At lunch Michael Nolan and I talked about coauthoring a journal article.
I imagined an article with Mike about the search for extraterrestrial intelligence in general – 35 years on – and what it has meant to astronomy and to society as a whole (pros and cons). There, I would mention the RuBisCo transmission but not focus on it. Instead, I would want to show how SETI has helped to drive a broad spectrum of research, providing jobs for astronomers and others and motivated millions of lay enthusiasts to contribute in spite of the lack of federal funding. I would also want to point out that Arecibo Radar is actively contributing significant knowledge about the cosmos almost daily. Some of it is “save-the-world” knowledge, like profiling near-Earth asteroids that will one day pose a real threat. They are mapping the lunar surface and subsurface with unrivaled detail, finding heretofore undiscovered pulsars and more.
I’d like to say I’ve had enough adventures for one week, but it’s not really true. Now I will have to balance books. I applied for two small grants to help me do this. Both were denied. I was not funded by MIT, the government, or anyone else to carry out this project. It has been expensive, at least, from my point of view. I do have the coolest iPhone now, so how can I complain? Who knows who’s going to be calling back?
Epilog
On Thursday evening (12 Nov) I learned that the journal Nature assigned the “rubisco stars” story to science writer Steve Nadis provided he could guarantee that Arecibo has not been used to send an “active SETI” message since 1974, which of course, is actually the case.
Then, according to Steve Nadis, Arecibo Director Mike Nolan told him there wasn’t any way he could write the story so that it could not potentially hurt him or Arecibo. So Nadis has put it on hold indefinitely… This has been especially poignant since Nadis, Nolan and myself remain uniformly committed to the importance of astronomy at Arecibo.
Funny, isn’t it? Aristotle knew that you have to reveal yourself to yourself before you can reveal yourself to anyone else (theory of tragedy in the Poetics). Tragically, it appears easier to transmit a signal to extraterrestrial intelligence than to transmit one to ourselves. It is tragic also that one of the most interesting items of knowledge about ourselves we can learn from our efforts to transmit messages to other stars is that most serious efforts to send messages to extraterrestrials have become mired in episodes of censorship.
by Paul Gilster | Nov 18, 2009 | Astrobiology and SETI |
by Joe Davis
We’ve looked before at the work of MIT biology research affiliate Joe Davis, whose passion is the melding of science and art. Among his many ideas are the creation of an ‘infogene,’ engineering a sign of human intelligence into the genome of bacteria that could be flung into the heavens by the trillion, and a three-masted Gulf Coast tower that would discharge laser beams into the sky. In 1986, Davis used MIT’s Millstone radar to beam a signal to Epsilon Eridani, Tau Ceti and two other stars. His most recent adventure takes him to the great telescope at Arecibo. It involves the 35th anniversary of the Drake/Sagan transmission to M13, a messaging strategy based on molecular biology, and the emergence of the coolest iPhone in the world.
What follows is a narrative describing events that took place just over one week ago:
I traveled from Boston to Puerto Rico on 03 November to deliver a lecture for the University of Puerto Rico’s Biology Colloquium (Rio Piedras campus) in San Juan. I also planned to meet with Arecibo Observatory interim Director, Dr. Michael C. Nolan to propose a project that would coincide with the 35th anniversary of the famous message for extraterrestrial intelligence that was transmitted into space from Arecibo by astronomers Frank Drake and Carl Sagan in 1974.
Poetic and philosophical implications underlying the scientific search for extraterrestrial intelligence (SETI) have marked much of my work and career as an artist. In the 1980s, technical problems associated with the use of radar and spacecraft as message-transmitters inspired me to develop prototype bacterial carriers of generic information that could survive for very long periods of time in the harsh environments of space. That is how a subject as vast in scope as the search for extraterrestrial intelligence ultimately brought me to the study of molecular biology.
Image: Arecibo close-up. Credit: Ashley Clark.
In 1974, molecular biology was entering its “golden age”. Part of the Sagan Drake message was encrypted with a rudimentary likeness of the DNA double helix. The hereditary role of DNA was then well known – as were two of the three principal conformations of its molecular structure – but the triplet operation of the genetic code had only recently been unraveled and modern techniques for DNA sequencing were still a few years away. The first genes (DNA) were sequenced in 1977 and the first recombinant organisms were produced in Herbert Boyer’s laboratory (UCSF) in 1978. In 1974, there was no genomic science at all. While messages were being transmitted to extraterrestrial intelligence no one knew that genetically speaking, human beings are 70% identical to tomatoes.
In 35 years since the Sagan-Drake transmission from Arecibo, radar antennae all over the world have more or less routinely searched the sky for unambiguous signals from advanced extraterrestrial civilizations. The SETI@Home project, organized by the Space Sciences laboratory at UC Berkeley has allowed millions of lay enthusiasts to participate in SETI sky surveys by donating processing time on home computers. Various amateur and commercially motivated transmissions have taken place, but such transmissions have been insufficiently powerful and arbitrarily or naively composed by groups and individuals from outside the formal, scientific community. No federal funds at all have been allocated for SETI searches and with the possible exception of Poetica Vaginal (ca. 1986), for almost 35 years, no serious scientific radio messages for extraterrestrial intelligence have been transmitted into space.
In late October of this year, I contacted members of the astronomy community at Cornell University for referrals to scientists and administrators at Arecibo Observatory (Cornell operates Arecibo Observatory under contract with the National Science Foundation). My objective at Arecibo was to carry out transmission of a new message to extraterrestrial intelligence on or around the 16 November anniversary of the 1974 Sagan-Drake transmission. To prepare for meetings at Arecibo Observatory, I organized recommendations and letters of support for the project from respected members of the international academic and research communities that were sent to Arecibo’s director on my behalf. Among these were recommendations from Dr. Irving Vega of University of Puerto Rico Biology and his Department Chair, Dr. Carmen Maldonado, art historian James Elkins, astronomer and editor, Dr. Roger Malina, CalPoly physics Prof. Peter Scwartz, University of Washington art historian, Marek Wieczorek, scientists from the biology community here in Massachusetts and abroad, members of the astronomy community at Cornell and others.
Image: Arecibo at night. Credit: Ashley Clark.
The RuBisCo Message
All living things are made of protein and the most abundant protein on Earth is called RuBisCo (ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually quite an interesting protein. To quote Wikipedia, it is “an enzyme that is used in the Calvin cycle to catalyze the first major step of carbon fixation, a process by which the atoms of atmospheric carbon dioxide are made available to organisms in the form of energy-rich molecules such as sucrose.” It is also interesting in that it actively selects against 13C, one of the naturally occurring stable isotopes of atmospheric carbon, in favor of 12C. The difference of course, is only a single neutron.
In a letter of support sent to Arecibo, Dr. Peter Weigele (staff scientist at New England Biolabs) wrote, “RuBisCo is not only the most abundant protein on earth, it is THE molecule, in all its many forms, that uses the energy supplied by photosynthesis to convert carbon dioxide into food. The choice of this molecule for broadcast communicates the central importance of our sun in sustaining life as well as an implicit understanding of the role of CO2 in our biogeochemical systems. This is a message that is both timely and timeless– for the Universe and here on Earth!”
The Gene for the large RuBisCo subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGT
GTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAG
GATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT
CCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGT
ACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTAC
AAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAA
TATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCT
GTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAA
GCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTAT
GTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGAT
AAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCT
AAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGT
CTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCA
CAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCA
CTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTG
AATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTT
GCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGG
GGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGT
CTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAG
AAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATG
TCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAA
GGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGAT
TTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGG
GTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTT
TGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA
CAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGT
GCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAAT
GAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCT
TGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAG
ATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
I pointed out that certain technical shortcomings of the 1974 Sagan-Drake transmission could be avoided with a follow-up transmission. I also found candidate stars that would be located in the Arecibo “window” (above 20 degrees from the horizon) in the first weeks of November (gleaned from online sky maps and SETI Institute Jill Tarter’s and Margaret Trunbull’s list of candidate ‘nearby habitable stellar systems’).
I established that aspects of the galactic rotation of target stars (which actually negated the Sagan-Drake effort) would be inconsequential when targeting stars located less than a few hundred light years away from the sun.
Image credit: Ashley Clark.
My friends at Cornell also suggested that since our best bet at finding ETI would be ones that are already quite sophisticated, targeting infrared sources in our galaxy that have no corresponding optical object should also be considered. Although I personally remain rather skeptical on this point, these objects could be Dyson Shells or other similar ETI astroengineering projects. The online data set of the IRAS could be used to identify such sources.
I proposed that a short message containing the RuBisCo sequence could be transmitted during some brief interval between scheduled ongoing use of Arecibo Radar or that it may coincide with periods set aside for checks and maintenance.
I was also advised incidentally, that no special ceremony or event was planned to mark the November 16 anniversary.
I arrived at Arecibo Observatory on Friday, 06 Nov. with several companions who had flown in to participate in the project. My companions included Jonathan, Pam and Rhode Island School of Design Prof. Emeritus, Al Wunderlich, film maker Peter Sasowsky, photographer and collaborator Ashley Clark and Belgian art historian, Danielle Hofmans.
Power outages caused by a lightning strike on Friday night postponed any use of Arecibo Radar until power transmission lines were repaired in time for the next night’s observations. I am now delighted to report that on Saturday night (07 Nov) we managed to send the RuBisCo gene sequence to three “nearby” stars:
1st star: GJ 83.1 (sent at 23:38:45 on 07 November 2009)
2nd star: Teagarden’s star SO 025300.5+165258
3rd star: Kappa Ceti (G5B)
The amazing thing is, we did it with my iPhone!
Image: Joe Davis pondering transmission options as he holds the possible answer. Credit: Ashley Clark.
Arecibo’s “coder” (a device that interrupts the 2 Megawatt radar signal at precise intervals) was down. Use of that component would have been the most obvious way to input data that would be reflected in Arecibo Radar’s transmitted signal. Creative solutions were called for. Inspired in part by techniques I used 25 years ago to interface with Millstone Radar for the Poetica Vaginal transmission, we converted the 1434-mer RuBisCo sequence into an analog audio file that I recorded on my iPhone. Then, we actually interfaced my iPhone with Arecibo’s powerful radar and transmitted from approximately 11:30 p.m. until 12:45 a.m. (see attached pictures). The duration of each transmission was approximately 5 times longer than the 1974 Sagan-Drake transmission.
Now I have the coolest iPhone in the world.
How best to send out a gene as a coded signal? More on that tomorrow, along with a look at ways to add additional information to the original message.
by Paul Gilster | Nov 17, 2009 | Culture and Society |
Focus on FOCAL
I’m just back from a weekend in Texas, meeting with Hal Puthoff and Eric Davis at the Institute for Advanced Studies in Austin and spending a great deal of time with Claudio Maccone, who flew in from Italy and goes on from Texas to a presentation at the SETI Institute. Our subject was largely FOCAL, the ambitious mission Maccone has championed to develop a spacecraft that can be sent to the Sun’s gravitational lens at 550 AU and beyond. Because gravity-focused radiation remains along the focal axis beyond 550 AU, such a spacecraft would continue making high-quality observations in various wavelengths long beyond this distance.
We live in an era of tight budgets and, to put it bluntly, lack of vision. Although FOCAL requires only near-term advances in technology and would represent the most ambitious undertaking ever attempted in space, the problem will be to find the funding to make it happen. A second issue is to develop a critical mass of scholarship in support of FOCAL to demonstrate the practicality and utility of the mission. Maccone’s books and papers have made an impressive contribution in this regard, but in coming weeks I’ll be discussing upcoming opportunities for others to make the case for FOCAL and turn a remarkable concept into an actual mission design.
Project Icarus in the News
Those of you who are members of the British Interplanetary Society will have access to Spaceflight, a monthly magazine the Society publishes to cover space developments. The December issue features Stephen Ashworth’s look at Project Icarus, introducing the project to BIS members and noting that the new design will take about five years to produce, with a final report scheduled to appear in 2014. The original Project Daedalus report is a classic, the only detailed study of a starship ever produced. Ashworth runs through the details of the September 30 meeting at BIS headquarters, and goes on to conclude:
…the baton has been passed to Project Icarus, and to a new generation of engineers and visionaries.
In this age of public pessimism about the problems of the environment, population growth and energy, with widespread doubts about whether industrial civilization itself is sustainable, and even the space agencies not daring to think long-term, it will take all the hard work of the Icarus team to refocus our future vision on the stars and thus reawaken public confidence in the boundless possibilities open to humanity.
Good luck, Icarus!
Quasars and the Celestial Grid
The International Astronomical Union’s new reference frame for celestial positions will be adopted by astronomers on January 1. Much as latitude and longitude can mark positions on Earth, the new references — 295 quasars — will denote positions in the sky. Improving the precision of this reference frame is the rationale behind linking thirty-five radio telescopes on seven continents to observe 243 of these quasars.
That event will occur in a 24-hour window starting on November 18 and ending the next day. The idea here is to make the grid ever more precise, a useful outcome for astronomers who routinely study objects in a wide range of wavelengths and need to overlay different images for detailed investigation. Quasars are ideal for calibrating such a grid because they’re readily observable and so distant as to appear motionless. And what a challenge for very long baseline interferometry, a technique long used for research but never deployed through so many telescopes. More in this news release.
Vatican Gathering Impressive
The recent five-day conference in Vatican City studying the possibility of extraterrestrial life was a high-grade affair. Thirty scientists attended the conference in a repeat of a 2005 gathering called by the Vatican to address similar issues. Meanwhile, the Vatican Observatory in Castel Gandolfo outside Rome continues to generate excellent research. “The questions of life’s origins and of whether life exists elsewhere in the universe are very suitable and deserve serious consideration,” says Gabriel Funes, director of the observatory, in this AP story.
I’m looking at the program for this meeting, seeing major names in astrobiology in abundance, including Jonathan Lunine (University of Arizona), Franck Selsis (University of Bordeaux), James Kasting (Penn State) and Eric Gaidos (University of Hawaii). Sara Seager (MIT) and David Charbonneau (Harvard-Smithsonian Center for Astrophysics) were there, and so were Jill Tarter and Paul Davies. Outstanding company indeed.
The AP story quotes Fr. Funes as saying, “If biology is not unique to the Earth, or life elsewhere differs bio-chemically from our version, or we ever make contact with an intelligent species in the vastness of space, the implications for our self-image will be profound.” Indeed.
by Paul Gilster | Nov 16, 2009 | Exoplanetary Science |
When the stars are properly aligned, expect remarkable things. How useful, for example, to find that a planet we would like to know much more about — HAT-P-7b, about 1000 light years from Earth — is not only providing intriguing transit information right now, but is also in Kepler’s field of view. We’d like to know whether there are massive outer planets in this system, or possibly a binary companion. These are questions that the Kepler observatory may be able to answer.
Any transiting exoplanet is obviously of high interest, but HAT-P-7b stands out a bit more following the publication of two recent papers in separate journals. Both used the Subaru Telescope to examine the planet’s unusual orbit, which appears to be retrograde or polar. This is useful stuff, because it’s telling us something about how planetary systems form, offering useful evidence about planetary migration models.
What we would expect is that planets that form in protoplanetary disks around young stars would have an orbital axis aligned with the stellar spin axis — this is certainly what we see in our own Solar System. But what we are finding around other stars compels us to look at planetary migration models that can disrupt this pattern. Interactions between giant planets or planets and a nearby companion star can cause tilted or retrograde orbits to occur, the latter being defined as orbits that are tilted by more than ninety degrees from the stellar spin axis.
A Japanese team led by Norio Narita (National Astronomical Observatory of Japan) worked with the Rossiter-McLaughlin effect, which produces a distortion in radial velocity data during a planetary transit. The diagram shows the effect, which is perceived as a change in the velocity of the star, but is actually the effect of the transiting planet on the star’s light. This is thorny, but bear with me: If a planet occults part of the approaching (blue-shifted) part of the star’s disk, the radial velocity of the star will appear to be slightly red-shifted, and vice-versa. The Rossiter-McLaughlin effect depends on the spin-orbit alignment of the system, which is why it is so useful.
Image: An illustration of the Rossiter-McLaughlin effect. As a star rotates, one part appears to be approaching, the other receding. During a planetary transit, we can see the Rossiter-McLaughlin effect as an apparent anomaly in the stellar radial velocity. The star appears to be receding if the transiting planet hides an approaching part and vice versa. We can observe this effect by precise radial velocity measurements. Note that if the planet orbits in a prograde manner, the planet first hides an approaching side and subsequently hides a receding side. Inversely, if the planet orbits in a retrograde manner, the effect occurs in reverse. Credit: National Astronomical Observatory of Japan.
Narita’s team found that HAT-P-7b shows clear evidence of a retrograde orbit, an observation confirmed by a US team led by Joshua N. Winn (MIT). So we have information about an unusual orbit but no migration model for this system, which is why finding other planets or a binary companion would be useful. Kepler’s help will be invaluable as we work to understand what appears to be a wide variety of planetary orbits, fitting these into theoretical models that explain the origin of each.
Image: The observational result of the Rossiter-McLaughlin effect on UT May 30, 2008 taken with the Subaru HDS (Narita et al. 2009). This figure shows that HAT-P-7b first hides a receding part of the star HAT-P-7 and subsequently hides an approaching side. National Astronomical Observatory of Japan.
The first paper is Narita et al., “First Evidence of a Retrograde Orbit of a Transiting Exoplanet HAT-P-7b,” Publications of the Astronomical Society of Japan Letters, Vol 61, No. 5 (2009), pp. L35-L40 (abstract). The second is Winn et al., “HAT-P-7: A Retrograde or Polar Orbit, and a Third Body,” The Astrophysical Journal Letters, Vol. 703, Issue 2 (2009), pp. L99-L103 (abstract).
